TABLE 2

Primers used in this study

Primer and categorySequence (5’–3’)a
Cloning
    403BamCmFTATGCGTGCGGGATCCTTATTTGCTGAAAATGAGGAATTAAAAAAAGA
    403SalCmRGTGCTTTGCCGCATGCGTCGACTTATAAAAGCCAGTCATTAGGCCT
    SgRNA_FGACTGGCTTTTATAAGTCGACGCATGCGGCAAAGCACTCAAAAGT
    SgRNA_RTCGAACCCGGGGTACCACTTAAAAAAAAACCGCGCCCT
    Cas9NcoFAGTATGATTCCCATGGATAAGAAATACTCAATAGGCTT
    Cas9XhoRTACCGAATTCCTCGAGGTCGACTTAGTCACCTCCT
sgRNA
    Phospho-sgRNA_promoter_RPhosphp-5′-TATAGTTATTATACCAGGGGGACAGTGC
    ezrA_lp_2328SgRNAGTTGCCGTTCCGTCAATTGAGTTTAAGAGCTATGCTGGAAACAG
    lp_p2645FTTTCCCTTAGTCGCAGCTGCGTTTAAGAGCTATGCTGGAAACAG
    mk277_sg_lp0001_dnaATCGAGTTGGAGTGGTTTTGCGTTTAAGAGCTATGCTGGAAACAG
    mk281_sg_lp1247ACACTTAAAAACGTGCCGATGTTTAAGAGCTATGCTGGAAACAG
    mk282_sg_lp2217CACCGTTGTTTCTGTGAATCGTTTAAGAGCTATGCTGGAAACAG
    mk276_sg_lp2189_divIVACCAAGAACGGTTGGACTCGAGTTTAAGAGCTATGCTGGAAACAG
    mk278_sg_lp3683 (eloR)ACCGTTAGCCGTACTTGGGCGTTTAAGAGCTATGCTGGAAACAG
    mk279_sg_lp1637 (spr0683)AACTAACGGGGTGACAACCGGTTTAAGAGCTATGCTGGAAACAG
ddPCR
    Lp_1247_FCACGATTACGAGTGTGACGA
    Lp_1247_RCTAGAAATCGTGTCGCCCAT
    Lp_2217_FCCATGGATGTTGGTCCAAGT
    Lp_2217_RCAAGATCGCATAGCCTGGAA
    Lp_2645_FATTCTGGAAAGTGGTTGGGG
    Lp_2645_RACTTCCGAAAAGCGTCTTGA
  • a Restriction sites are indicated in italics; base-pairing regions in the sgRNA primers are underlined.