TABLE 5

Complete sequences of PCR primers utilized in this study

PrimerTargetSequence (5′ – 3′)
prJA0047HIS3 FPCAGAAGCAGTAGCAGAACAG
prJA0048HIS3 RPATGGTCGTCTATGTGTAAGTC
prJA0051RPS14A FPAGAGTTACTGGTGGTATGAAG
prJA0052RPS14A RPCTGGAGTCTTGGTTCTAGTAC
prJA0053ELO2 FPCTGGTGGAAGGAATGGGTTAC
prJA0054ELO2 RPAGTTGTTGAACCCACACAGTC
prJA0055MRPL27 FPTAAAAGAGTGCCGTTGACCAC
prJA0056MRPL27 RPTGGGGTAACATAGGTTCTGAC
prJA0057SAF1 FPTCCCAGTGGTTCACAGCATGA
prJA0058SAF1 RPCCGTGGTATTGACAGTACTC
prJA0063SNT1 FPAGGGGTGTATTTTCCCATTAC
prJA0064SNT1 RPGTGCGTAAAAAGGATACTCTG