TABLE 2

IS with TIR closely related to those of ISAba12 and MITEAba12

IS nameaIRL sequenceIRR sequenceLength (bp)TSD (bp)
MITEAba12GGCTTTGTTGCACAAAGGCTTTGTTGCATAAA1139
ISAba12GGCTTTGTTGCACAAAGGCTTTGTTGCACAAA1,0399
IS17GGCTTTGTTGCACAAAGGCTTTGTTGCACAAA1,0409
ISAba5bGGCTTTGTTGCACAAAGGCTTTGTTGCATAAA1,044ND
ISAba7GGCTTTGTTGCATAAAGGCTTTGTTGCACAAA1,0399
ISAba10GGCTTTGTTGCATAAATAGGCTTTGTTGCACAAATA1,0239
ISAba13GGCTTTGTTGCACAAAGGCTTTGTTGCACAAA1,0399
ISAba40GGCTTTGTTGCACAAAGGCTTTGTTGCACAAA1,0399
ISAha1GGCTTTGTTGCACAAACGGCTTTGTTGCACAAAC1,0394
ISAha2GGCTTTGTTGCACAAAGGCTTTGTTGCACAAA1,040ND
ISAha3GGCTTTGTTGCACAAAGGCTTTGTTGCATAAA1,039ND
ISAjo1GGCTTTGTTGCACAAAGGCTTTGTTGCATAAA1,0393
ISAlw1GGCTTTGTTGCACAAAGGGCTTTGTTGCACAAAG1,038ND
ISEcl7GGCTTTGTTGCACAAAGGCTTTGTTGCATAAA1,0529
ISNov2GGCTTTGTTGCGCAAATGGCTTTGTTGCATAAAT1,0489
  • a Abbreviations: IS, insertion sequence; IRL, inverted repeat left; IRR, inverted repeat right; TSD, target site duplication; ND, not determined.

  • b The transposase of ISAba5 is thought to be inactive (28).