TABLE 4

Primers used in this study

Primer function and nameSequencea (5′–3′)Reference or source
Cloning and sequencing of hns genes
with integrated mobile genetic elements
 hns_FGAGACATATGATGCATCATCATCATCATCATATAAATATTAAGAAAATATATTA27
 hns_RTCTCGGATCCTTAGATTAAGAAATCTTCAAG27
    M13 FGTAAAACGACGGCCAGPromega
    M13 RCAGGAAACAGCTATGACPromega
Identification of presence of IS
    ACX60_04650_FCGTATTTGGGTCTTGGGGAAThis study
    ACX60_04650_RCCTTTGGTAAGTACTTTATThis study
    ACX60_18935_FAGCAACTGAAGCTGAAATTCG27
    ACX60_18935_RTTGGTTCCGAATTAGACTTGC27
    ACX60_04795_FCAGTCAGGTTCGCCATThis study
    ACX60_04795_RGACCAGACAATACAATGThis study
Construction of ΔqseBC and ΔygiW
    ΔqseBC
    ΔqseBC_UFR_FCAATTCCGCGATAAGAGCThis study
    ΔqseBC_UFR_RCTATCAACACACTCTTAAGCCTGTTATATCCTGATThis study
    ΔqseBC_DFR_FCGGGAGGAAATAATTCTATTTGCAGTCACAACTGGThis study
    ΔqseBC_DFR_RGTAGTAACCAGAACAGCACThis study
    ΔqseBC_NOL_FGGCAAGGACGTCCTGTTTThis study
    ΔqseBC_NOL_RGGGCTGAAAAACTTCAACThis study
    ΔqseBC_Ery_FCTTAAGAGTGTGTTGATAG39
    ΔqseBC_Ery_RATAGAATTATTTCCTCCCG39
    ΔygiW
    ΔygiW_UFR_FCAGTTGAAATGGCATCCATTACThis study
    ΔygiW_UFR_RCTCTTAAGGTATAGGAACTTCAAAATTACCCTCTGTTAThis study
    ΔygiW_DFR_FGAGGAAATAAGAAGTTCCTATACTAAATTAATTTCTACATTTATTCCThis study
    ΔygiW_DFR_RGAGAGCGGCCGCCTCATTTTAAGTCTCCCATACThis study
    ΔygiW_NOL_FCGGCATTTATGAGTTTATGCCAGThis study
    ΔygiW_NOL_RGGCTTGCCCCAACTGAThis study
    ΔygiW_Ery FGAAGTTCCTATACCTTAAGAGTGTGTTGATAGThis study
    ΔygiW_Ery RGTATAGGAACTTCTTATTTCCTCCCGTTAAATAATAGATAACThis study
  • a Nucleotides in boldface represent incorporated restriction sites: NdeI, CATATG; BamHI, GGATCC; NotI, GCGGCCGC.