TABLE 2

Primers used in the study

PrimerSequence
RT-PCR
    CpHac1_RT6TGGGAAACTTTTCACAAAATACG
    CpHac1-RT7TCACACCATAAATCAATCCAACTC
    ACTFGAAGCTTTGTTCCGTCCAGC
    ACTRTGATGGAGCCAAAGCAGTGA
HAC1 deletion in Candida parapsilosis
    CpHAC1_KO1ATACCCCCTTTGGATCAATT
    CpHAC1_KO3CACGGCGCGCCTAGCAGCGGGACTAGTATGTGTGGGCTTA
    CpHAC1_KO2CCGCTGCTAGGCGCGCCGTGACCAGTGTGATGGATATCTGC (universal primer)
    CpHAC1_KO5GCAGGGATGCGGCCGCTGACGCGCAACCTTCCGGAGTATAGCTCGGATCCACTAGTAACGa
    CpHAC1_KO4GTCAGCGGCCGCATCCCTGCAATAATCAAGTTATTTTTAG
    CpHAC1_KO6CCTCATTCAGTGGGAGTG
    CpHAC1_5′Check_2CGATGAAACGCAGTAGCAAA
    CpHAC1_3′CheckTATAACACAAGAAAACAATC
    LEU check 1GAAGTTGGTGACGCGATTGT
    LEU check 2TTCCCCTTCAATGTATGCAA
    HIS check 1AAAATCAATGGGCATTCTCG
    HIS check 2TGGGAAGCAGACATTCAACA
    CpHac1_check_RTTTCCACCTCTTCTTGAACCA
    CpHac1_ORF_FCCACCTAGGAAGAGAGCCAAG
  • a The barcode present in primer CpHAC1_KO5 is shown in bold and underlined.