TABLE 2

Primers and probes used in this study

Primer or
probe
SequenceDescription
F (UNR511)GAATGAAATGGTCTGGAAAGAAAGForward primer used in the RT-PCR analysis
of Fig. 5
R1 (UNR525)GGATAAATGTTAGAAGATTTTCReverse primer used in the RT-PCR analysis
of Fig. 5
R2 (UNR513)CTGTTAGAATGACAGAACTTATGReverse primer used in the RT-PCR analysis
of Fig. 5
R3 (UNR512)GTAGGCTGTGTGAGTCTTTATGReverse primer used in the RT-PCR analysis
of Fig. 5
R4 (UNR529)GATATAGAGGATTTATCCTGATTTAATCReverse primer used in the RT-PCR analysis
of Fig. 5
R5 (UNR531)GAGCAAGTACACACAGACAATATReverse primer used in the RT-PCR analysis
of Fig. 5
R6 (UNR534)GTGAAGTTACAAAAACGTGTATGReverse primer used in the RT-PCR analysis
of Fig. 5
UNR342CGTTATGTAAAACAAAACTCTATTGAGUsed with UNR343 to create a probe for the
Northern blot shown in Fig. 5
UNR343TCAGTCAGGCTTAGCTATTTCTATTAACTGUsed with UNR342 to create a probe for the
Northern blot shown in Fig. 5
proS.UTMFTACCACTGGCAAATCGTACCTaqMan primer to detect proS
proS.UTMRCATTTCAACAGCACCGATCTTaqMan primer to detect proS
proS.UTMPCACGCATGATGGTCTTGAATTTCTCATaqMan probe to detect proS
grab.TMFGCATCAGTATTAGTCGGTTCAACAGTTaqMan primer to detect grab
grab.TMRGGTTCCGCCATTTGGAATAATaqMan primer to detect grab
grab.TMPTGTTGACTCACCTATCGAACAGCCTCGATaqMan probe to detect grab
scpCTMFAAGGAGCTTGGGACAAGGGATATaqMan primer to detect scpC
scpCTMRTGATGGGCCGGATCGATaqMan primer to detect scpC
scpCTMPCAATAACTGCGACAACCTTGCCTTGTCCTTaqMan probe to detect scpC
hasATMFATGATCGATGTTTAACAAATTATGCTATTGTaqMan primer to detect hasA
hasATMRTTAAATAACTTTTTAATTGGAAAGGTACATCAGTaqMan primer to detect hasA
hasATMPACGCACTGTCTACCAATCAACAGCTAGATGTGTaqMan probe to detect hasA
rocATMFAGGGCTATAAGCGCAAAGAATaqMan primer to detect rocA
rocATMRGGCTTTCTTTCCAGACCATTTaqMan primer to detect rocA
rocATMPTGAGCCAACATCACAACATCAAGAATGTaqMan probe to detect rocA
sloTMFGACCTTTAAAGAGTTGCAACGAAAATaqMan primer to detect slo
sloTMRGACCATAAGCTACGTTACTCACAAAGATaqMan primer to detect slo
sloTMPTGTCAGCAATGAAGCCCCGCCTaqMan probe to detect slo