TABLE 1

ECF σ-dependent promoters mapped in this study by 5′-RACE mapping or previously identified by RNA-Seq

Unique
identifiera
GeneDescriptionLog FCbSequencec
SMc01022Cytochrome b-like protein1.6, RpoE1; 1.9, RpoE3GAAAGCGAATAAAAACGAGGCCGCGGGCGTCTAATCGGA
SMc01021Conserved hypothetical
protein
NC
SMc01418Hypothetical signal peptide
protein
5.9, RpoE1; 2.7, RpoE4GCCGGGAATAAATCCATAGCCCTCCGTGTCTTATCCTCG
SMc01419rpoE1RpoE1 σ factor5.9, RpoE1
SMc01420*ecfR1EcfR1 anti-σ factor4.1, RpoE1
SMc01421*ecfR1EcfR1 anti-σ factor3.0, RpoE1
SMc02156Adhesin-like protein with
periplasmic binding fold
3.6, RpoE1; 2.1, RpoE4GAGGGAAGAATTGCGCCCTTCGAACAGTCGTTTCTCCTG
SMc04291Dehydrogenase0.8, RpoE1GAAGGGAATAGTATGACACGGCGTTCCGTCTCACTGCGA
SMc02713rpoE3RpoE3 σ factor3.7, RpoE3CTTGCAGACTTAGGACCAAATGTTCCATATCATTGATGG
(RpoD promoter motifs)
SMc02714decfR3EcfR3 anti-σ factorNC
SMb20556Conserved hypothetical
protein
1.0, RpoE2; 1.5, RpoE3;
1.4, RpoE4; 1.3,
RpoE6; 1.5, RpoE7
CGTTGTTTTCTGGCCAGCGTGAGCATACCAGATCATGTG
(RpoH2 promoter motifs)
SMc04049Sulfite oxidase0.8, RpoE1; 4.4, RpoE4;
2.7, RpoE6; 1.1, FecI
CGAGGGAATTTTCCGGGGCGTCAGTCGTCTCTTCCAGTc
SMc04048Cytochrome c-like protein4.9, RpoE4; 2.5, RpoE6
SMc04047Pseudoazurin1.1, RpoE1; 4.5, RpoE4;
2.6, RpoE6; 0.9, FecI
SMc04046Conserved hypothetical
protein
2.2, RpoE4ACCTTCATGATTTACGTTGACCGACCTAAATCATGAAGG
(RpoD/RpoH promoter motifs)
SMc04051rpoE4RpoE4 σ factor1.8, RpoE1; 0.8, RpoE3;
6.1, RpoE4; 1.7, RpoE6
TCATGGAATAAGCGAGGCAGCTCGCTCGTCTCTACGCCG
SMc04050ecfR4EcfR4 anti-σ factor1.7, RpoE1; 0.9, RpoE3;
4.1, RpoE4; 1.6, RpoE6
SMb21484rpoE5RpoE5 σ factor5.9, RpoE5; 4.8, RpoE2CCTCAGGAACCAAAGGGCCGGAAAGGCATTTCCTAAc
SMb21687EcfR5 anti-σ factor?4.1, RpoE2
SMa0143rpoE6RpoE6 σ factor4.5, RpoE6CATTGGACGATGAGACCGCTACCTGTAGATTGTGTCAGa
SMa0144ecfR6EcfR6 anti-σ factor3.6, RpoE6CTGCCGGAATAACACAGGCGACCGGACGTTCTCAGTCAA
SMa0139Glyoxylase superfamily
enzyme
2.6, RpoE6GGATTGAATACTTTATGTACCCGTGCGACTTTCGAAACG
SMa0142Serine protease0.7, RpoE4; 4.7, RpoE6AAGAGGGAATAGACCGACGACTCAGCCGTTCTGACACAa
SMa_sRNA_10sRNA1.0, RpoE6TTCGAAAGTCGCACGGGTACATAAAGTATTCAATCCGCC
SMa0148Conserved hypothetical
protein
6.5, RpoE6ACGGAATAGAAGCCTCTCCGTTCCGTTACTCCCGGGCCA
SMa0187Short-chain dehydrogenase3.3, RpoE2; 2.5, RpoE6TCGCCCAAACCTTTTGGCCTCGCCAACGTTCTACCTCCt
SMb20065Hypothetical protein3.3, RpoE2; 0.7, RpoE6CAAAAGGAACTCCGGGCCCCCGGCCGCCGTTTCCGGGTT
SMb20074Hypothetical protein4.6, RpoE2; 0.9, RpoE6GCCGATGGAACTTCGCCTACGGCTTCACGTTGCCCTCCT
SMb20075Hypothetical protein3.7, RpoE2
SMb20522PRC-barrel-domain protein3.1, RpoE2; 1.9, RpoE6TCGAAGGAACAAGTTGCCTGACGCCCCGTTAGGCACCTg
SMb20933exsGSensor histidine kinase3.6, RpoE2; 1.2, RpoE6CGGACGGGGAACAAAGCAGCGGTCACTGCGTTTTTTGAA
SMb20934exsFResponse regulator1.7, RpoE2
SMb21442Hypothetical protein4.4, RpoE2; 2.0, RpoE6GGGGCGGAACAAATGGACGGTCGCGCCGTTTGAAACTCG
SMb21441CBS-domain protein3.8, RpoE2; 1.4, RpoE6
SMc01509Hypothetical protein4.5, RpoE2; 2.9, RpoE6TTACCGAAACAAATTCCTCCCTCATGCGTTGATCTACAA
SMc01508Hypothetical protein2.6, RpoE2; 1.4, RpoE6
SMc01609ribH26,7-Dimethyl-8-ribityllumazine
synthase
0.6, RpoE6AATTGTTCAGGGGCGTGAAATCCTTGGAAAATTCTGTCG
(RpoD promoter motifs)
SMb20530Conserved hypothetical
membrane protein
6.8, RpoE7AATGTAACATCGCTCCCGGTGGCTGCGAATGACGGACTG
SMb20529Conserved hypothetical
protein, DUF692 family
6.2, RpoE7
SMb20528Conserved hypothetical
protein, DUF2063 family
5.1, RpoE7
SMb20527Conserved hypothetical
protein
4.7, RpoE7
SMb20531rpoE7RpoE7 σ factor6.1, RpoE7ACATGTAACAAGTAGCGAAACTCGGCGAATTGGGAGGAA
SMb20532ecfR7EcfR7 anti-σ factor3.5, RpoE7
SMb20592rpoE8RpoE8 σ factor7.0, RpoE8GGGAACATTTCCGGAGATAGGGCATCCAATATCCGAGAA
SMb20593eConserved hypothetical
protein
NCGGGAACGTTTCGAGCCGCGAAGCATCCAAAGCATGTCGT
SMb20594amcYAmicyaninNC
SMb20029Carboxymuconolactone
decarboxylase
0.8, RpoE7; 1.9, RpoE9CCATGTCACACCGGCGGCCGCTGTCTCGTCATGGTGTCG
SMb20030rpoE9RpoE9 σ factor5.0, RpoE9
SMb20475Conserved hypothetical
protein
1.3, RpoE10ACGATGTCGGATCGGTTGCGGCTGGTGCGTCATCGTATCA
SMb20474Conserved hypothetical
protein
1.1, RpoE10
SMc01151YCII-related proteinNCTTTCGCCCCGCTTGTCGGCTATCAATAGCGCCATTCGTC
SMc01150rpoE10RpoE10 σ factor4.9, RpoE10
SMc01149Conserved hypothetical
protein
1.6, RpoE10CCCTGTCGGCAGGCGGCATCCTCCTTCGTCCTTGGAATg
SMc01148Conserved hypothetical
protein
1.8, RpoE10
SMc04203fecIFecI σ factor5.7, FecINo TSSs identified by RNA-Seq or 5′-RACE
SMc04204dfecRFecR anti-σ factorNCSee Data Set S2e
SMc04205dIron/heme transport proteinNCSee Data Set S2e
  • a Previously reported RpoE2-dependent promoters are not shown, unless also identified as dependent on another ECF σ factor in this study. An identifier in italics indicates that the gene is predicted to be in an operon (22) with the gene(s) listed directly above. An asterisk indicates Affymetrix probe sets, designed for two putative pseudogenes of Rm1021, which hybridize to ecfR1 mRNA in strains with a WT ecfR1 allele.

  • b Log fold change of increased expression for ECF σ overexpression strains compared to the wild type. NC, no change. RpoE2 data were previously published (22); only those RpoE2-dependent genes whose promoter appears to be activated by other ECF σs in addition to RpoE2 are shown. Log FC is expressed as the log2 ratio of the change, i.e., a log FC of 1 equals a 2-fold change.

  • c Putative ECFσ-dependent promoters determined by 5′-RACE mapping, as described in Materials and Methods. The transcription start site (TSS) is in boldface. RNA-seq TSSs identified by Schlüter et al. (22) are in standard boldface, TSSs identified by 5′-RACE mapping are in italic boldface, and TSSs identified by both methods are in lowercase boldface. Sequences within putative −35 and −10 motifs, corresponding to the underlined cross-species consensus sequences in Fig. 3, are underlined. SMc04046, rpoE3, and rpoE6 putative promoter regions have motifs similar to those found in promoters activated by RpoD and RpoH (22, 37, 38).

  • d Putative TSS was detected by 5′-RACE mapping, but no conserved promoter motifs were identified.

  • e 5′-RACE mapping and RNA-Seq (22) of SMb20593 failed to identify a TSS. We used sequence upstream of the SMb20593 ATG (start) codon (and 1 nt downstream of the rpoE8 stop codon) for consensus motif development because it matches nearly perfectly with the putative RpoE8 promoter motif identified upstream of rpoE8 and is similar to consensus motifs identified for group ECF29 σs (31).