TABLE 2 

Assays designed and validated in this study

Clade, group,
or ST
AssayPrimer/probe
name
Probe labelsaSequencebProduct
length (bp)
Clade CC8 (including ST239
and ST630)
CC8_B+tCC8_FCGAGTCAGCTAGTGGTCCGTT88
tCC8_RATGCATAGCTCTTGCTAAAGTGTA
tCC8-A_FB+FAM, BHQ-1plusACCTATACCTGAACGTCAA
non-tCC8-G_TB+TET, BHQ-1plusCTATACCTGAGCGTCAAA
Inner CC8 clade (excluding ST239
and ST630)
inCC8_B+inCC8_FTGCCCATAACACATTTGACACTTT79
inCC8_R1TTCGGCCACAGCTAAACTCG
inCC8_R2GTTCGGCTACAGCTAAACTTGC
inCC8_FB+FAM, BHQ-1plusATCGGACCCGGTAACC
non-inCC8_TB+TET, BHQ-1plusTAATCGGACCTGGTAACC
Clade CC8a (Archaic
and Iberian)
CC8a_B+CC8a_FCGCCAAATGACTCGCATTGT241
CC8a_RGCATGTGCCTTTCCGAARTAAA
CC8a-C_FB+FAM, BHQ-1plusATTACTGTAGCAGGGCTG
nonCC8a-T_TB+TET, BHQ-1plusCTGTAGCAGGGTTGC
Clade CC8bCC8b_B+CC8b_FGATGACGTGATAACTGTACGTSGAT240
CC8b_RCGCGATTGAGGGTGAATATTGC
CC8b-C_FB+FAM, BHQ-1plusAAGCTAACAAAATCACCTACTG
nonCC8b-T_TB+Tet, BHQ-1plusCAAAGCTAACAAAATTACCTAC
Clade CC8c
(USA500/Iberian)
NewIber_B+NewIber_FGCGCAACAGGGAAGCAA118
NewIber_RTGCGGATGTCCTATGTCTGAAAG
NewIber-T_FB+FAM, BHQ-1plusTGCACTTACATATCATCCAT
nonNewIber-C_TB+Tet, BHQ-1plusCACTTACATACCATCCATC
Group CC8ec (USA500,
Early Branching USA300,
and USA300-SAE)
CC8e_B+CC8e_FACCTTATACRGAACATAGCAGACG106
CC8e_RTCGATGCGCTTCTATCACTTC
CC8e-C_FB+FAM, BHQ-1plusTATTAGATGAAGGCCTCAATA
nonCC8e-T_TB+TET, BHQ-1plusTTTATTAGATGAAGGCTTCAATA
Clade CC8fc (USA300-NAE)CC8f_B+CC8f_FCCTGAAGAAGAAGAGCGTTTAAGAA208
CC8f_RRCATCCTACGATGGCCGAATC
CC8f-T_FB+FAM, BHQ-1plusTAAACGTCGTAAAGTAGAACAA
nonCC8f-A_TB+TET, BHQ-1plusACGTAAACGTCGTAAAGAAGAAC
ST239ST239_B+ST239_FCATGACCGCCACTATAACCAGA99
ST239_RATGCAACATTAGCAGGAGGATG
ST239-C_FB+FAM, BHQ-1plusTACGACTGACCTGATGC
non239-T_TB+TET, BHQ-1plusCGACTGACTTGATGCC
  • a FAM, 6-carboxyfluorescein; BHQ, black hole quencher; TET, tetrachlorofluorescein.

  • b Nucleotides in boldface in each probe sequence are the phylogenetically informative canonical SNP state targeted by the assay.

  • c USA300-NAE isolates will test positive on this assay.