TABLE 2

Primers used in this study

PrimerSequence (5′ to 3′)a
Deletion constructs
    5389GOIF1KpnIATAGGGTACCGAAGAACACCACCCACTGCT
    5389SOEGOIR1AAGTACGAAGGCGACTCGACCATGGAGAAGCCCATTACCGAGAAGC
    5389SOEGOIF1GCTTCTCGGTAATGGGCTTCTCCATGGTCGAGTCGCCTTCGTACTT
    5389GOIR1BamHIATCGTCTTCGCTGTTTTTCC
Protein expression construct
    5389Mal-c2xFGCATCAGAATTCTCCCAGGACTTCTGGTTTCT
    5389Mal-c2xRGCATCAAAGCTTTCAGCCTCGCTCAGCTCGA
Primer extension
    5388primerextension5′-Fluorescein 6-FAM-ACTGGCCAGGATCAGCAGG
    5389primerextension5′-Fluorescein 6-FAM-AGACAGTATCGGCCTCAGGAA
EMSA probes
    PA5388promF3AAGCTTGTGCCAGCGGTAGAGGTC
    PA5388promRTGAGGTACCTTGATTGTTTTTCTGCGAGGT
    PA5388promRbiotBiotin-TTGATTGTTTTTCTGCGAGGT
    5389EMSA-FATGAAAGCTTGCAGCAGGAGAAACCAGAAG
    5389EMSA-R-biotBiotin-TTGATTGTTTTTCTGCGAGGT
    5389EMSA-Mut3FGGACGGCGGCGAAGCGCACTGCGAAGACC
    cbcXprom-FCCGGCAAAGACCACTATGAT
    cbcXprom-R-biotBiotin-GAACTCCTCTGCAGGGTAAGG
    dhcprom-F-biotBiotin-GAGGCTTTCCTCCAGGCTCT
    dhcprom-RGGATGGTACCCTCTTCCGGCTCTTGTGATT
    dhcprom-FGAACTCCTCTGCAGGGTAAGG
Transcriptional reporters
    PA5388promRTGAGGTACCTTGATTGTTTTTCTGCGAGGT
    PA5388promF1ATGAAAGCTTACAGCAGGTCGCCTTTCTT
    PA5388promF3AAGCTTGTGCCAGCGGTAGAGGTC
    PA5388promF2ATGAAAGCTTGCAGCAGGAGAAACCAGAAG
    PA5388promF4AAGCTTCTGCAGTGCAAGAGCTGGT
    P5388posATGAAAGCTTCGCTTGGCAATGGCCAGGTCGCT
    P5388mut1ATGAAAGCTTCGCTTGGCAATGGCCAAATCGCT
    P5388mut2ATGAAAGCTTCGCTTGGCAATGGCCAGAACGCT
    P5388mut3ATGAAAGCTTCGCTTGGCAATGGCCAGGAAGCT
    P5388mut4ATGAAAGCTTCGCTTGGCAATGGCCAGGTAACT
    P5388mut5ATGAAAGCTTCGCTTGGCAATGGCCAGGTCAAT
    P5388mut6ATGAAAGCTTCGCTTGGCAATGGCCAGATCGCT
Translational reporters
    2-lacZCtermFhindclaGCAAGCTTATTATCGATGAGCGTGGTGGTTATGC
    2-lacZCtermRsmakpnCGGTACCCGGGGATCCTTATTTTTGACACCAGACC
    YFP R HindIIIGCATCAAAGCTTATTACTTGTACAGCTCGTCCA
    YFP F Kpn SalGACAGCGGTACCAATCGTCGACCATATGCTGAGCAAGGGCGAGG
    88-89YC-DR#2ycFGGGCACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCAGCATGGGGCGCTCCGGGGTTGA
    88-89YC-DR#2ycRCGGCACCACGCCGGTGAACAGCTCCTCGCCCTTGCTCAGCATCGGTCTCCCCTCGTGCGG
  • a 6-FAM, 6-carboxyfluorescein.