TABLE 5

Primers, probes, and cycling conditions used in this study

Primer
name
Gene
target
TaxonSequence (5′–3′)aConcn
(final, nM)
PCR
conditionsb
Reference(s)
Bif F16S rRNA Bifidobacterium GCGTGCTTAACACATGCAAGTC600A 52
Bif R16S rRNA Bifidobacterium CACCCGTTTCCAGGAGCTATT600A 52
Bif P16S rRNA Bifidobacterium 6-FAM–TCACGCATTACTCACCCGTTCGCC–BHQ1250A 52
BiLONF16S rRNA B. longum groupCAGTTGATCGCATGGTCTT900B 53
BiLONR16S rRNA B. longum groupTACCCGTCGAAGCCAC900B 53
BiLONSpP16S rRNA B. longum group6-FAM–TGGGATGGGGTCGCGTCCTATCAG–TAMRA250B 53
Blon0915FBlon0915 B. longum subsp.
infantis
CGTATTGGCTTTGTACGCATTT900CThis study
Blon0915RBlon0915 B. longum subsp.
infantis
ATCGTGCCGGTGAGATTTAC900CThis study
BI915 PRBBlon0915 B. longum subsp.
infantis
6-FAM–CCAGTATGG–ZEN–CTGGTAAAGTTCACTGCA–
3IABkFQ
250CThis study
515F16S rRNABacteria,
universal
GTGYCAGCMGCCGCGGTAA200A 43, 44
806R16S rRNABacteria,
universal
GGACTACNVGGGTWTCTAAT200A 43, 44
Probio-bifUniITSc region Bifidobacterium CTKTTGGGYYCCCKGRYYG1,000A 54
Probio-bifRevITS region Bifidobacterium CGCGTCCACTMTCCAGTTCTC1,000A 54
  • a 6-FAM, 6-carboxyfluorescein; BHQ1, Black hole quencher 1; TAMRA, 6-carboxytetramethylrhodamine; ZEN, ZEN quencher; 3IABkFQ, Iowa Black fluorophore quencher.

  • b Reaction conditions: A, as described in the text; B, 2 min at 50°C, then 40 cycles of 15 s at 95°C and 60 s at 58°C; C, 2 min at 50°C, 10 min at 95°C, and then 40 cycles of 1 s at 95°C and 60 s at 60°C.

  • c ITS, internal transcribed spacer.