TABLE 5

Primers, probes, and cycling conditions used in this study

Primer
name
Gene
target
TaxonSequence (5′–3′)aConcn
(final, nM)
PCR
conditionsb
Reference(s)
Bif F16S rRNABifidobacteriumGCGTGCTTAACACATGCAAGTC600A52
Bif R16S rRNABifidobacteriumCACCCGTTTCCAGGAGCTATT600A52
Bif P16S rRNABifidobacterium6-FAM–TCACGCATTACTCACCCGTTCGCC–BHQ1250A52
BiLONF16S rRNAB. longum groupCAGTTGATCGCATGGTCTT900B53
BiLONR16S rRNAB. longum groupTACCCGTCGAAGCCAC900B53
BiLONSpP16S rRNAB. longum group6-FAM–TGGGATGGGGTCGCGTCCTATCAG–TAMRA250B53
Blon0915FBlon0915B. longum subsp.
infantis
CGTATTGGCTTTGTACGCATTT900CThis study
Blon0915RBlon0915B. longum subsp.
infantis
ATCGTGCCGGTGAGATTTAC900CThis study
BI915 PRBBlon0915B. longum subsp.
infantis
6-FAM–CCAGTATGG–ZEN–CTGGTAAAGTTCACTGCA–
3IABkFQ
250CThis study
515F16S rRNABacteria,
universal
GTGYCAGCMGCCGCGGTAA200A43, 44
806R16S rRNABacteria,
universal
GGACTACNVGGGTWTCTAAT200A43, 44
Probio-bifUniITSc regionBifidobacteriumCTKTTGGGYYCCCKGRYYG1,000A54
Probio-bifRevITS regionBifidobacteriumCGCGTCCACTMTCCAGTTCTC1,000A54
  • a 6-FAM, 6-carboxyfluorescein; BHQ1, Black hole quencher 1; TAMRA, 6-carboxytetramethylrhodamine; ZEN, ZEN quencher; 3IABkFQ, Iowa Black fluorophore quencher.

  • b Reaction conditions: A, as described in the text; B, 2 min at 50°C, then 40 cycles of 15 s at 95°C and 60 s at 58°C; C, 2 min at 50°C, 10 min at 95°C, and then 40 cycles of 1 s at 95°C and 60 s at 60°C.

  • c ITS, internal transcribed spacer.