TABLE 1

Primers used to create single guide RNAs (sgRNAs), a donor plasmid, and a qPCR plasmid standard

Primer nameSequence (5'-3')Description
sgRNA ForwardCACCGTTGGAATGTGGACTTAAGGAsgRNA to US6 stop codon
sgRNA ReverseAAACTCCTTAAGTCCACATTCCAACsgRNA to US6 stop codon
Primer 1CGGCCCAATTTAATCAAGG US6 homology arm, forward
Primer 2AGGATGGTGAGTTGTATGTA US6 homology arm, reverse
Primer 3GTCCACATTCCAATCGAGTT US7 homology arm, forward
Primer 4AACACCGAAAGGCCAAATAC US7 homology arm, reverse
Primer 5ATGGATAGCACTGAGAACGTDsRed Express2, forward
Primer 6TTACTGGAACAGGTGGTGGCDsRed Express2, reverse
Primer 7ACTCACCATCCTATGGATAGCACT US6/DsRed overhang, forward
Primer 8TGGAATGTGGACTTACTGGAACAG US7/DsRed overhang, reverse
Primer 9AGTGCTATCCATAGGATGGTGAGT US6/DsRed overhang, reverse
Primer 10CTGTTCCAGTAAGTCCACATTCCA US7/DsRed overhang, forward
US7 plasmid standard forwardCTTTCCGGTCCTGTCTCCACqPCR forward primer
US7 plasmid standard reverseGGTTAAATCTTACCCGCAGTGCqPCR reverse primer