TABLE 3

Primers used in this study to introduce SNPs and verify sequencing

Oligonucleotide no.Oligonucleotide nameSequence (5′–3′)aPurpose
0159ETV-hapR-ForwardGATCGGAATTCCCATTTCCTACTTGAAGCTGTAGCGGTGTTGGCAGAllelic exchange
0160ETV-hapR-SapI-ReverseGATCGGCTCTTCACGTCAGTACTCCAACTTCTTGACCGATCACATCGAllelic exchange
0161ETV-hapR-SapI-ForwardGATCGGCTCTTCAACGAACCACAAAATTCAGCACATCGTCAACCAAGTCTTCAllelic exchange
0162ETV-hapR-ReverseGATCGAGATCTCAGTATCGCTGACTTTGGTGGCGCGTATAGTACCAllelic exchange
0163ETV-luxO-ForwardGATCGGAATTCGCTGGATATTGATATCAATATCGTGGGTACCGGAllelic exchange
0164ETV-luxO-SapI-ReverseGATCGGCTCTTCACGCCTTGACGCTCAGTCGCCGCCCCAGTAAAAGCAllelic exchange
0165ETV-luxO-SapI-ForwardGATCGGCTCTTCAGCGTGGCAGAAGCGGCTGATGGGGGAACCCTCTTTTTGGAllelic exchange
0166ETV-luxO-ReverseGATCGAGATCTGCTTGTTCAATGGCTTGTTTTTCGGTCATCCACAGCAllelic exchange
0167ETV-hns-ForwardGATCGGAATTCGGTTTATTTATGGCGGGTTACACCGAAGATTCCGAllelic exchange
0168ETV-hns-SapI-ReverseGATCGGCTCTTCAGTGAAGAAAAAACTTGGACAGGCCAAGGCCGTACTCCAllelic exchange
0169ETV-hns-SapI-ForwardGATCGGCTCTTCACACTGTTGGTGTCGATATACTTGTATTTTGCAGGGCGAGGAllelic exchange
0170ETV-hns-ReverseGATCGAGATCTCAATCATTTCATTGATACTTATTTCATAAAAACACCAllelic exchange
0171ETV-vieA-ForwardGATCGGAATTCGGTCGGGGTTCCGTTGTACACCTCATGCTCCGTCAllelic exchange
0172ETV-vieA-SapI-ReverseGATCGGCTCTTCATCAGCGCTGTGGAAGATACGATTCTTGAGTTAACAllelic exchange
0173ETV-vieA-SapI-ForwardGATCGGCTCTTCATGAATATCACCACACCTAGCTTAGGTGCCTGTAAACTCAGAllelic exchange
0174ETV-vieA-ReverseGATCGAGATCTCAGTCGTTATCTCACAACACAATGGGTCGCACTGCCAllelic exchange
0212 hapR-UpstreamGCATTGTATAAATGGGGCTTGGAGAATTTAGGCGSequencing
0213 hapR-DownstreamGCTCAGTGATCTGTTGACCTAATTCGCGAATGCGSequencing
0214 hns-UpstreamGCATTAGCTTTAACAGGAGAAAGCGATCCGCTCGCSequencing
0215 hns-DownstreamGCAACTAGGTTCCAGTGAGAAAAACAAGTGCCACAGCSequencing
0216 luxO-UpstreamGGCTAGGCTATGCAACATAATCAATCTTTGCAGSequencing
0217 luxO-DownstreamCCAAGTTTGCAGCTTGCGATAGATGGTTGACGGSequencing
0218 vieA-UpstreamGCAGTTGAGCCAGTTGACCTAATGACGCGTAACCSequencing
0219 vieA-DownstreamGCGGAACAAGCTCTGCAAGCGGGTATGGATAAGGSequencing
  • a Italics represent regions of enzyme restriction sites.