TABLE 2

Primers used in this study

PrimerSequenceaPurpose
57.I_VicR_XhoI_SGTAACAACTCGAGTGTATTTTACTPCR for SL17_CΔvicRKX construction
57.I_VicX_SphI_ASGAGGAATTCCTAGCATGCCTAA
CH1_GtfG_SGCTAATCAAGTGACCAATG
CH1_GtfG_BamHI_ASCCAGTTGTTTCGGATCCTGTCTT
CH1_GtfG_XhoI_SGATAAGACATCTCGAGCCAATTCT
CH1_Spec_ASCTCTCCAAGATAACTACGAACTGCT
CH1_VicR_STTTCAACCATGGAACGCTTCAPCR for SL17_ΔvicRKX construction
CH1_VicR_XhoI_ASCATCTCGAGAGCTTCACGACCATCAA
CH1_VicR_BamHI_SATCGGATCCGACGACTATGTGACTAAG
CH1_VicR_ASTGCATATCCAGAACCTCAGA
57.I_GlnR_NcoI_SAGGCCATGGATGGCAAGAGAGAAAGAPCR for SL17_CΔglnR construction
57.I_GlnR_BamHI_ASAAAGGATCCTTAGATACGCAAGTTACCAAA
CH1_GlnR_SGGAAATGTAACGTATATCTATCCAA
CH1_GlnR_NcoI_ASCATCCATGGCCTCCTTTCGTAAGATATG
CH1_GlnA_XbaI_STGTTCTAGACCATAAGGAGATCACCATGCC
CH1_GlnA2_ASGCGAGTTCCCATGCCGCGAGATGCTG
CH1_SGO_0212_SCAAGATAGGATATAGAGGGTGAPCR for SL17_ΔglnR construction
CH1_GlnR_XhoI_ASTGCTCGAGTACGACGCAGTT
CH1_GlnR_SphI_SCTGCATGCAAGCGTAAGTATG
CH1_GlnA1_ASACATGCACGTAGAACTTCATCA
EMSA_CTD_21_S CCTGTAAATGTTGCAAAATCCEMSA probe for analyzing the binding of α-CTD to VicR box
EMSA_CTS_21_AS GGATTTTGCAACATTTACAGG
GlnR_PstI_SAGTTCCTGCAGTTATTAGATACGCAAGPCR for His-GlnR construction
GlnR_BamHI_ASGAGGGGATCCATGGCAAGAGAGAAAGA
GlnR_box 1_SalI_STGAGTCGACTGTAAATGTTGCAAAATTTCInverse PCR to mutate GlnR box 1
GlnR_box 1_SalI_ASACAGTCGACTCAAGC GCCGCT GTGGTGTCAA
GlnR_box 2_NsiI_STTTATGCATACATGTTAGCTTGACTAATATGTAAATGInverse PCR to mutate GlnR box 2
GlnR_box 2_NsiI_ASTGTATGCATAAAAAAGCTAGTTACATTTGGTAATTCT
GlnR_box-1_SACCACATGTTAGCTTGACTAATATGTAAATDAPA and EMSA probe for analyzing the binding of GlnR to the GlnR box
GlnR_box-1_ASATTTACATATTAGTCAAGCTAACATGTGGT
GlnR_box-2_SAATGTAATGTCATTTTTTGACACCACATGT
GlnR_box-2_ASACATGTGGTGTCAAAAAATGACATTACATT
mGlnR_box-1_SACCACAGTCTTATGTAAAGTCATTGTAAAT
mGlnR_box-1_ASATTTACAATGACTTTACATAAGACTGTGGT
mGlnR_box-2_SAATGTAAGTCTTATCTATCCATTGACATGT
mGlnR_box-2_ASACATGTCAATGGATAGATAAGACTTACATT
pMAL_VicR_EcoRI_SAAGGAATTCCTAGTCATAATTCTTCATATAPCR for MalE-VicR construction
pMAL_VicR_PstI_ASAAGCTGCAGTGAAATCTCCTGCTTACCAGA
pMAL_GlnR_EcoRI_SAGGGAATTCATGGCAAGAGAGAAAGAATTAAGGCGPCR for MalE-GlnR construction
pMAL_GlnR_PstI_ASTTCCTGCAGTTATTAGATACGCAAGTTACCAAATTG
pureI_4870_SCGGACTATATTGTCAGAAACAGTCUsed in ChIP-PCR
pureI_5090_ASCACCTAACATAAGAACCTCCTAAG
pureI_VicR_box_SalI_SATAGTCGACTGTTGCAAAATTTCTGAAAInverse PCR to mutate VicR box in 57.I
pureI_VicR_box_SalI_ASACAGTCGACTATTAGTCAAGCTAACATG
pureI_320_SalI_SAAAGTCGACCAAATTTCTGAAAATTCGTTGInverse PCR to mutate VicR box in CH1
pureI_320_SmaI_ASTTTGTCGACCCCGGGTATTAGTCAAGCTAA
VicR_BamHI_SGGTGGATCCATGAAAAAAATTCTAGTAGTTPCR for His-VicR construction
VicR_PstI_ASAAGCTGCAGTGAAATCTCCTGCTTACCAGA
VicR_box_SCTAATATGTAAATGTTGCAAAATTTCTGAADAPA and EMSA probe for analyzing the binding of VicR to the VicR box
VicR_box_ASTTCAGAAATTTTGCAACATTTACATATTAG
mVicR_box_SCTAATACTAGTGTAATAATAGTATTCTGAA
mVicR_box_ASTTCAGAATACTATTATTACACTAGTATTAG
  • a Inserted restriction recognition sites and mutated sequences are underlined.