TABLE 3 

Bacterial strains, plasmids, and oligonucleotides used in this study

Strain, plasmid,
or oligonucleotide
FeaturesSource
P. aeruginosa
    PAO1Wild type61
    ΔgcsR PAO1ΔgcsR derivative of PAO1This study
    PW5126 gcsR-E03::ISphoA/hah48
    ΔmexF PW5126ΔmexF derivative of PW5126This study
    lecA::luxΔlasR PAO1ΔlasR derivative of lecA::lux PAO162
E. coli
    JW2779-5ΔgcvA736::Kmr63
    JW2464-1ΔgcvR727::Kmr63
    BL21 fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdSEMD Millipore
    Top10FmcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15ΔlacX74 nupG recA1araD139
Δ(ara-leu)7697 galE15 galK16 rpsL (Strr) endA1 λ
Invitrogen
    OP50Strain used for C. elegans growth59
Plasmids
    pBBR1MCS-5Broad-host-range plasmid; Gmr64
    ΔPlac-pBBR1MCS-5pBBR1MCS-5 minus lac promoter; Gmr12
    pCR-BluntCloning plasmid; KmrInvitrogen
    pET28bExpression plasmid; KmrEMD Millipore
    pTrc99aExpression plasmid; CbrPharmacia
    pDONR221Cloning plasmid; KmrInvitrogen
    pEX18ApGWPlasmid for gene deletions in P. aeruginosa; Cbr54
    pBRL408 gcsR in pCR-Blunt; KmrThis study
    pBRL417 gcsR in pET28b; Kmr12
    pBRL620-3 gcsR cloned in backwards in pTrc99a; CbrThis study
    pBRL620-5 gcsR cloned in forwards in pTrc99a; CbrThis study
    pBRL456PgcvH2-lacZ fusion in ΔPlac-pBBR1MCS-5; Gmr12
    pBRL518 mexF::Gmr in pDONR221; Gmr KmrThis study
    pBRL521 mexF::Gmr in pEX18ApGW; Cbr GmrThis study
    pBRL527 gcsR::Gmr in pDONR221; Gmr KmrThis study
    pBRL528 gcsR::Gmr in pEX18ApGW; Cbr GmrThis study
    pMTG01 rhlI in pCR-Blunt; KmrThis study
    pMTG02 rhlI in pBBR1MCS-5; GmrThis study
    pZS406PgcvH2 probe in pJET1.2; Cbr12
    pZS416PPA5530 probe in pJET1.2; CbrThis study
    pZS420PgcvH2-mut1 probe in pJET1.2; CbrThis study
Oligonucleotides
    BL439.f GCATCTAGAAGAAGGAGACATATGATCGAATTGCTCTCTGAATCG rhlI gene with XbaI at start
    BL439.r GCAGAGCTCTTCACACCGCCATCGACAGC rhII gene with SacI at stop
    BL452.f TACAAAAAAGCAGGCTGCATCCACGTCTCCTTCATC gcsR UpF-GWL
    BL452.r TCAGAGCGCTTTTGAAGCTAATTCGCAACGCATCGAGCTGCAAG gcsR UpR-Gm
    BL453.f AGGAACTTCAAGATCCCCAATTCGCACTTCATGCAGCAGGCCTG gcsR DnF-Gm
    BL453.r TACAAGAAAGCTGGGTCTGACGTAGAGCTTCTCCAG gcsR DnR-GWR
    BL454.f TACAAAAAAGCAGGCTGAATTTCTCCCAATTCTTCATCC mexF UpF-GWL primer
    BL454.r TCAGAGCGCTTTTGAAGCTAATTCGGAAGGTGATGGTCAGGGTC mexF UpR-Gm
    BL455.f AGGAACTTCAAGATCCCCAATTCGGCAAGAACGCGATCCTGATC mexF DnF-Gm
    BL455.r TACAAGAAAGCTGGGTCATGCATGCACCTCTGGCAG mexF DnR-GWR
    BL456.f GGCTCGAGTTTTTCAGCAAGAT pJET1.2
    BL456.r GAATATTGTAGGAGATCTTCTAGAAAG pJET1.2
    JRH05.f GGCTCGAGTTTTTCAGCAAGAT 5′ Cy5-labeled pJET1.2
    JRH05.r GAATATTGTAGGAGATCTTCTAGAAAG 5′ Cy5-labeled pJET1.2
    ZS420F CGTTCCACTCGTCCCCGAAGCCCCACAGCCGATGGCACATCTTGCTG PgcvH2-mut1
    ZS420R CAGCAAGATGTGCCATCGGCTGTGGGGCTTCGGGGACGAGTGGAACG PgcvH2-mut1
    ZS426F GGCTCGAGTTTTTCAGCAAGATGAGTGGAACGAATTCGTTCCGATTGCAGGAAAAACCTT PgcvH2-2
    ZS426R TTGTAGGAGATCTTCTAGAAAGAAGGTTTTTCCTGCAATCGGAACGAATTCGTTCCACTC PgcvH2-2
    ZS422F GGCTCGAGTTTTTCAGCAAGATGAGTGGGGCGAATTCGGGCCGATTGCAGGAAAAACCTT PgcvH2-2-mut
    ZS422R TTGTAGGAGATCTTCTAGAAAGAAGGTTTTTCCTGCAATCGGCCCGAATTCGCCCCACTC PgcvH2-2-mut
    ZS431F GGCTCGAGTTTTTCAGCAAGATGGCGGGTCTGTAACGAAAGCGTTCCATGGCGGCCCTG PgcvH2-3
    ZS431R TTGTAGGAGATCTTCTAGAAAGCAGGGCCGCCATGGAACGCTTTCGTTACAGACCCGCC PgcvH2-3
    ZS425F GGCTCGAGTTTTTCAGCAAGATGGCGGGTCTGTGGCGAAAGCGCCCCATGGCGGCCCTG PgcvH2-3-mut
    ZS425R TTGTAGGAGATCTTCTAGAAAGCAGGGCCGCCATGGGGCGCTTTCGCCACAGACCCGCC PgcvH2-3-mut
    ZS416F CACTGAGAGCCAAGCGATC PPA5530
    ZS416R CGCGGGAAAGCCGCGTGGGGAC PPA5530
    ZS448F ACGCCGCCGGCAGTGAAGTG gcvH2-gcvP2 RT probe
    ZS448R TTGCGCGCGGCGATCGCC gcvH2-gcvP2 RT probe
    ZS449F CCGCCGCCGAACTGCTCG gcvP2-glyA2 RT probe
    ZS449R GGATAGCCCTCGGCATACTTG gcvP2-glyA2 RT probe
    ZS454F CAGGGGCTGACCGGCAAG glyA2-sdaA RT probe
    ZS454R GCTGGAACGGATGGCATCG glyA2-sdaA RT probe
    ZS451F GTCCAGGTGCCCTGCATCG sdaA-gcvT2 RT probe
    ZS451R GCCACATCGGCGCCCACC sdaA-gcvT2 RT probe
    ZS452F CAAGGTCGAGAAACTCGACGTCG rplU RT probe
    ZS452R GACGCTTCATGTGGTGCTTACGAC rplU RT probe