TABLE 3 

Bacterial strains, plasmids, and oligonucleotides used in this study

Strain, plasmid,
or oligonucleotide
FeaturesSource
P. aeruginosa
    PAO1Wild type61
    ΔgcsR PAO1ΔgcsR derivative of PAO1This study
    PW5126gcsR-E03::ISphoA/hah48
    ΔmexF PW5126ΔmexF derivative of PW5126This study
    lecA::luxΔlasR PAO1ΔlasR derivative of lecA::lux PAO162
E. coli
    JW2779-5ΔgcvA736::Kmr63
    JW2464-1ΔgcvR727::Kmr63
    BL21fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdSEMD Millipore
    Top10F mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15ΔlacX74 nupG recA1araD139
Δ(ara-leu)7697 galE15 galK16 rpsL (Strr) endA1 λ
Invitrogen
    OP50Strain used for C. elegans growth59
Plasmids
    pBBR1MCS-5Broad-host-range plasmid; Gmr64
    ΔPlac-pBBR1MCS-5pBBR1MCS-5 minus lac promoter; Gmr12
    pCR-BluntCloning plasmid; KmrInvitrogen
    pET28bExpression plasmid; KmrEMD Millipore
    pTrc99aExpression plasmid; CbrPharmacia
    pDONR221Cloning plasmid; KmrInvitrogen
    pEX18ApGWPlasmid for gene deletions in P. aeruginosa; Cbr54
    pBRL408gcsR in pCR-Blunt; KmrThis study
    pBRL417gcsR in pET28b; Kmr12
    pBRL620-3gcsR cloned in backwards in pTrc99a; CbrThis study
    pBRL620-5gcsR cloned in forwards in pTrc99a; CbrThis study
    pBRL456PgcvH2-lacZ fusion in ΔPlac-pBBR1MCS-5; Gmr12
    pBRL518mexF::Gmr in pDONR221; Gmr KmrThis study
    pBRL521mexF::Gmr in pEX18ApGW; Cbr GmrThis study
    pBRL527gcsR::Gmr in pDONR221; Gmr KmrThis study
    pBRL528gcsR::Gmr in pEX18ApGW; Cbr GmrThis study
    pMTG01rhlI in pCR-Blunt; KmrThis study
    pMTG02rhlI in pBBR1MCS-5; GmrThis study
    pZS406PgcvH2 probe in pJET1.2; Cbr12
    pZS416PPA5530 probe in pJET1.2; CbrThis study
    pZS420PgcvH2-mut1 probe in pJET1.2; CbrThis study
Oligonucleotides
    BL439.fGCATCTAGAAGAAGGAGACATATGATCGAATTGCTCTCTGAATCGrhlI gene with XbaI at start
    BL439.rGCAGAGCTCTTCACACCGCCATCGACAGCrhII gene with SacI at stop
    BL452.fTACAAAAAAGCAGGCTGCATCCACGTCTCCTTCATCgcsR UpF-GWL
    BL452.rTCAGAGCGCTTTTGAAGCTAATTCGCAACGCATCGAGCTGCAAGgcsR UpR-Gm
    BL453.fAGGAACTTCAAGATCCCCAATTCGCACTTCATGCAGCAGGCCTGgcsR DnF-Gm
    BL453.rTACAAGAAAGCTGGGTCTGACGTAGAGCTTCTCCAGgcsR DnR-GWR
    BL454.fTACAAAAAAGCAGGCTGAATTTCTCCCAATTCTTCATCCmexF UpF-GWL primer
    BL454.rTCAGAGCGCTTTTGAAGCTAATTCGGAAGGTGATGGTCAGGGTCmexF UpR-Gm
    BL455.fAGGAACTTCAAGATCCCCAATTCGGCAAGAACGCGATCCTGATCmexF DnF-Gm
    BL455.rTACAAGAAAGCTGGGTCATGCATGCACCTCTGGCAGmexF DnR-GWR
    BL456.fGGCTCGAGTTTTTCAGCAAGATpJET1.2
    BL456.rGAATATTGTAGGAGATCTTCTAGAAAGpJET1.2
    JRH05.fGGCTCGAGTTTTTCAGCAAGAT5′ Cy5-labeled pJET1.2
    JRH05.rGAATATTGTAGGAGATCTTCTAGAAAG5′ Cy5-labeled pJET1.2
    ZS420FCGTTCCACTCGTCCCCGAAGCCCCACAGCCGATGGCACATCTTGCTGPgcvH2-mut1
    ZS420RCAGCAAGATGTGCCATCGGCTGTGGGGCTTCGGGGACGAGTGGAACGPgcvH2-mut1
    ZS426FGGCTCGAGTTTTTCAGCAAGATGAGTGGAACGAATTCGTTCCGATTGCAGGAAAAACCTTPgcvH2-2
    ZS426RTTGTAGGAGATCTTCTAGAAAGAAGGTTTTTCCTGCAATCGGAACGAATTCGTTCCACTCPgcvH2-2
    ZS422FGGCTCGAGTTTTTCAGCAAGATGAGTGGGGCGAATTCGGGCCGATTGCAGGAAAAACCTTPgcvH2-2-mut
    ZS422RTTGTAGGAGATCTTCTAGAAAGAAGGTTTTTCCTGCAATCGGCCCGAATTCGCCCCACTCPgcvH2-2-mut
    ZS431FGGCTCGAGTTTTTCAGCAAGATGGCGGGTCTGTAACGAAAGCGTTCCATGGCGGCCCTGPgcvH2-3
    ZS431RTTGTAGGAGATCTTCTAGAAAGCAGGGCCGCCATGGAACGCTTTCGTTACAGACCCGCCPgcvH2-3
    ZS425FGGCTCGAGTTTTTCAGCAAGATGGCGGGTCTGTGGCGAAAGCGCCCCATGGCGGCCCTGPgcvH2-3-mut
    ZS425RTTGTAGGAGATCTTCTAGAAAGCAGGGCCGCCATGGGGCGCTTTCGCCACAGACCCGCCPgcvH2-3-mut
    ZS416FCACTGAGAGCCAAGCGATCPPA5530
    ZS416RCGCGGGAAAGCCGCGTGGGGACPPA5530
    ZS448FACGCCGCCGGCAGTGAAGTGgcvH2-gcvP2 RT probe
    ZS448RTTGCGCGCGGCGATCGCCgcvH2-gcvP2 RT probe
    ZS449FCCGCCGCCGAACTGCTCGgcvP2-glyA2 RT probe
    ZS449RGGATAGCCCTCGGCATACTTGgcvP2-glyA2 RT probe
    ZS454FCAGGGGCTGACCGGCAAGglyA2-sdaA RT probe
    ZS454RGCTGGAACGGATGGCATCGglyA2-sdaA RT probe
    ZS451FGTCCAGGTGCCCTGCATCGsdaA-gcvT2 RT probe
    ZS451RGCCACATCGGCGCCCACCsdaA-gcvT2 RT probe
    ZS452FCAAGGTCGAGAAACTCGACGTCGrplU RT probe
    ZS452RGACGCTTCATGTGGTGCTTACGACrplU RT probe