TABLE 3

Oligonucleotides used for gene amplification and cloning

GenePrimersSequence (5′–3′)aTm (°C)Reference
flaC (Cj0720c)CjflaC_F_BamHIAAAGGATCCCAAAGTGGCTTAATGATGACG55This study
CjflaC_R_BamHIAAAGGATCCCGCTAGAGCTTGGACTTGAT55This study
CjflaC_F3AAAGGATCCATCTCTGATGCAACTATGATG53This study
CjflaC_R2AAACTCGAGTTGTAATAAATTAGCAATTTTGC51This study
rdxA (Cjj81176_1083)CjrdxA_ClaI_R3AAAATCGATGTTGATTGTAACATAGGGTTG51This study
CjrdxA_SpeI_F3AAAACTAGTCAAGTGCGAGTCATAATATC51This study
CjrdxA_XbaI_F1AAATCTAGAGTGATTTTGTCGTAGATGAAG53This study
CjrdxA_XbaI_R1AAATCTAGATATAAATTTCCAAGGTTCCA51This study
SalTy LT2 fliCSalLT2FliCBamHI(F)CGGGATCCATGGCACAAGTCATTAATAC49This study
SalT2FliCEcoRI(R)CGGAATTCCGCAGTAAAGAGAGGACG51This study
chTLR5 chTLR5_F1AAAGGTACCGAGTCCGGATCCATGATGTTACAATCAA
CGGCTAATAATTG
65This study
chTLR5_R1AAAAGCGGCCGCCGTGTGAGACTGTCGCTATAGTTTG69This study
CAT cassettepCAT1AACAGCTATGACCATGATTAC57 81
pCAT2_BamHIAGAGGATCCGATATCGCATGCCTGCAGAG57 81
Gm cassette (aac)Gm1_ClaIAAAATCGATCGGGTGACTAACTAGGAGGAATAA65This study
Gm2_SpeIAGAACTAGTCCGTGTCATTATTCCCTCCAGGTA67This study
  • a Restriction sites in oligonucleotides are underlined. Tm, melting temperature.