TABLE 2

RT-qPCR primers

Gene nameAssembly 19/21 identifierPrimer sequenceTemp (°C)
Forward primerReverse primerAnnealingReading
ACT1orf19.5007GTTGGTGATGAAGCCCAATCCCCAGTTGGAAACAATACCG6272
CDC19orf19.3575TTGTCCACCAGTGGTCTTTCAGCAGCTCTTTCGTTTCTGG6070
CTN1orf19.4551GGATTTGGTCCAGTTTCTGCTGACGATGTTTGGAACTAGCAC6070
CTN3orf19.2809CTTTCCAGTGCCATGTCTTCTGTTGCGGTAAGTGGCTATC6175
ICL1orf19.6844CAGCATTGGCTGTTGATGACTGGACAGTTTGACCGTAAGC6070
LSC2orf19.1860AGCTGAAGCCGGTAAATACGGCCAAACCAGCACCATTAAC6073
MLS1orf19.4833CAGCTTTGGTTCCAGTTGTGGTTCCTTTGGTGGCAATGAG6072
PMA1orf19.5383CCGAAGCCTTTGACAACTTCCTCTTTGCATGGACACAAGG6073
POT1orf19.7520TGGCTGAAGCCAAAGGTTACGGACCAACACCCATGATTTC6175
POX1-3orf19.1652GAAGGCTCATCACTACCTGTTGGCAATGGTGAGCAAGTATGG6072