TABLE 3

Primers used in this study

PrimerDNA sequence (5′–3′)Description
16S rRNA forwardCTTACCAGGTCTTGACATCCCqRT-PCR
16S rRNA reverseCCAACATCTCACGACACGAGqRT-PCR
nlmA forwardATGGATACACAGGCATTTCqRT-PCR
nlmA reverseTATGGGGTAACAAGAGTCCqRT-PCR
nlmB forwardTGTCAGAAGTTTTTGGTGGAqRT-PCR
nlmB reverseAGCACATCCAGCAAGAATAqRT-PCR
nlmC forwardAGCATATGGACCAAGAAATGqRT-PCR
nlmC reverseACGTAATGGATAATGAAGCACqRT-PCR
nlmD forwardGGGTGGTGGTATGATTAGqRT-PCR
nlmD reverseAACGACTGGGAGAGTAACqRT-PCR
comE forwardTCATACTGCCGTAGAATTCAqRT-PCR
comE reverseAAGAATGGTCAATCAGAGGAqRT-PCR
smu_833 SalI forwardGACCGTGTCGACAATGAAAAAACTTTCAATAGpVPT-TAP::smu_833
smu_833 KpnI reverseGGTCAGGGTACCTCCTTTTTCCTTAACpVPT-TAP::smu_833