TABLE 1

Primer sequences (5′ to 3′)

Primer nameSequencea
ForwardReverse
TbMtr2-RNAiTAGGATCCATGTCGGAATACGCAGATTGC CCAAGCTTTTACTCCTTTTCACTTAACCAGCG
TbMex67-RNAiTCGGATCCTTTTTGATTCTCTGTGGTATCTGGCCAAGCTTTGGCAACACTCTACGGTGTC
3×-Ty-TbMtr2GTAAAGATATAAAAAGAAATATATTACATATAT
ATATCAAGTGAAGGAACAGCTCTAACGACTCTC
ATCACTTATTACCAgtataatgcagacctgctgc
TTATCTAACAGTTGGTAAAACTGCTGGCGAAA
TCAAGCGCCTTCTTAGCCACTTCCGTGCAATCT
GCGTATTCCGACATactacccgatcctgatcc
3×-Ty-TbMex67AAAAGAAAAAAGAAGAATAGAGAAAAAAGGA
AAAGAATCCAAGGCGTCAATTAATAATAAGGT
GAGTTTAAAGGGTTAAAgtataatgcagacctgctgc
TTGTTCGCGCATGACCCTCTTTTAAAGTAGACA
CACGGTATACGCGATGTATCCTTGTTTTTCCTGT
ATGGGTTGGGCATactacccgatcctgatcc
  • a Lowercase sequences are pPOTV-6-specific sequences. Uppercase sequences are target-specific sequences.