TABLE 4 

Primers used in this study

Primer Sequence (5′ − 3′)aReference
oriV-FGAACAAGCGATCCGTCATGCThis study
oriV-RTCGTTGCTAGGACTTGTCTGGThis study
clpL-FACAGGCTCGTGATGGCTTACThis study
clpL-RACCGCGATATTGAGTTCCCGThis study
BamHI clpL FNNNNNGGATCCAGTTTCAAAGGTCGTTCTGGCThis study
BamHI clpL RNNNNNGGATCCTCTATCAAGCAATCTCCTTCCCThis study
NC16GTCAAAACATACGCTCTTATC61
PL95ACATAATCAGTCCAAAGTAGATGC61
ESAT-6 FGCAATCAGTGGGAAGGACTGThis study
ESAT-6 RATCCATCGCTTGTTTTCCTGThis study
secA-FACTACTGCCAAAACATCGAAGCThis study
secA-RAAGACGCACTGGATTCCCTCThis study
  • a The bases in the sequences are shown as follows: N, any of the bases, i.e., adenine (A), cytosine (C), guanine (G), or thymine (T). Restriction sites in the sequences are underlined.