TABLE 5 

Primers used in the study

Primer purposeGene (GenBank accession no.)Primer nameSequence (5′ to 3′)
Detection of kanamycin resistance genesaphA1 (AF093572)aphA1-FCGTCAGCCAGTTTAGTCTG
aphA1-RCAATCAGGTGCGACAATC
aphA2 (U66885)aphA2-FGGCTATTCGGCTATGACTG
aphA2-RGGACAGGTCGGTCTTGAC
aadB (JN119852)aadB-FTACTATGCCGATGAAGTACC
aadB-RCAAGACCTCAACCTTTTCC
Amplification of zeo in pCR-BluntzeooBBI 465CGATAGCTGAATGAGTGACGTGCTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGCTTACAATTTCCTGATGCa
oBBI 466GCATAGAGCAGTGACGTAGTCGCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCACGTGTCAGTCCTGCTCCa
Synthesis of an aphA1 knockout fragment by amplification of oBBI 465/466-zeoaphA1oBBI 467CAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACGATAGCTGAATGAGTGACGTGCb
oBBI 468GGATACTGCCAGATATCGGCGTCCAGGGAGATGTCCTGAAGCATAGAGCAGTGACGTAGTCGCb
Synthesis of a hilA knockout fragment by amplification of oBBI 92/93-neohilAoBBI 490GAATACACTATTATCATGCCACATTTTAATCCTGTTCCTGTATCGATAGCTGAATGAGTGACGTGCc
oBBI 491CAAATATTGTCTTCGTTTTTAAATTTATTCCACATTTTCTCGGCATAGAGCAGTGACGTAGTCGCc
  • a The 5′ end contains a universal binding region and FRT sites. The underlined sequences bind pCR-Blunt to amplify zeo.

  • b Boldface indicates homology to aphA1 for gene knockout. Underlined sequences bind oBBI 465/466-zeo.

  • c Boldface indicates homology to hilA for gene knockout. Underlined sequences bind oBBI 92/93-neo.