TABLE 1 

Primer and probe sequences

AgentGene targetForward primerReverse primerProbea
Borrelia burgdorferiospACCTTCAAGTACTCCAGATCCATTGAACAAAGACGGCAAGTACGATCFAM-CAACAGTAGACAAGCTTGA-MGB
Borrelia miyamotoiflaBAGCACAAGCTTCATGGACATTGAGAGCTGCTTGAGCACCTTCTCVIC-TGTGGGTGCAAATCAGGATGAAGCA-BHQ
Babesia microticox1CATCATGCCAGGCCTGTTTGGAAGAAACCACAAGAGCAAATGCQuasar 705-TACTACCCATACTGGTCGGTGCTCC-BHQ
Anaplasma phagocytophilum16S rRNAGGCATGTAGGCGGTTCGGTCACTAGGAATTCCGCTATCCTCTCCCy5-GCCAGGGCTTAACCCTGGAGCT-BHQ
Powassan virus3′-UTRGTGATGTGGCAGCGCACCCTGCGTCGGGAGCGACCATexas Red-CCTACTGCGGCAGCACACACAGTG-BHQ
  • a Abbreviations: FAM, 6-carboxyfluorescein; MGB, minor groove binder; BHQ, black hole quencher dye.