TABLE 1 

Primers used to create single guide RNAs (sgRNAs), a donor plasmid, and a qPCR plasmid standard

Primer nameSequence (5'-3')Description
sgRNA ForwardCACCGTTGGAATGTGGACTTAAGGAsgRNA to US6 stop codon
sgRNA ReverseAAACTCCTTAAGTCCACATTCCAACsgRNA to US6 stop codon
Primer 1CGGCCCAATTTAATCAAGGUS6 homology arm, forward
Primer 2AGGATGGTGAGTTGTATGTAUS6 homology arm, reverse
Primer 3GTCCACATTCCAATCGAGTTUS7 homology arm, forward
Primer 4AACACCGAAAGGCCAAATACUS7 homology arm, reverse
Primer 5ATGGATAGCACTGAGAACGTDsRed Express2, forward
Primer 6TTACTGGAACAGGTGGTGGCDsRed Express2, reverse
Primer 7ACTCACCATCCTATGGATAGCACTUS6/DsRed overhang, forward
Primer 8TGGAATGTGGACTTACTGGAACAGUS7/DsRed overhang, reverse
Primer 9AGTGCTATCCATAGGATGGTGAGTUS6/DsRed overhang, reverse
Primer 10CTGTTCCAGTAAGTCCACATTCCAUS7/DsRed overhang, forward
US7 plasmid standard forwardCTTTCCGGTCCTGTCTCCACqPCR forward primer
US7 plasmid standard reverseGGTTAAATCTTACCCGCAGTGCqPCR reverse primer